Philip’ and ‘Tagg
(names, names, names and DNA)
To Philip Tagg's Home page

 

To topTagg — English family name, probably of North German origin. Since it is an English name, it is pronounced exactly like the English word tag [tæg]. It is written with two Gs to distinguish it from the word tag. Though less common than Smith or Jones, Tagg is not an unusual English surname: there are tens of thousands of us.

Many English Taggs seem to hail from the southern part of Lincolnshire (check HERE or HERE) previously known as Holland (flat as a pancake and a lot of it under sea level).

The earliest Tagg I've found so far is Juliana, a potter from Toynton (probably Toynton All Saints, near Spilsby in central Lincolnshire).

“In 1364 Juliana Tagg took two crofts from the lord, Pottercroft and Wellcroft, for a term of years, during which time 'neither the lord nor his heirs shall disturb the said Juliana from digging and selling clay in the said croft pro ollis faciendis to whomsoever she pleases'.”
From Documentary Evidence and the Medieval Pottery Industry, by H. E. Jean Le Patourel, p. 114.

Taggs seem to have abounded in the area between Spalding and the Norfolk border. For example, in the mid nineteenth century Abraham Tagg married Cassandra Hunter, Benjamin Tagg married Jane Cooper, John Tagg married Mary Mashford and Thomas Tagg married Mary Parker, all in Fleet, Holbeach or Whaplode. My paternal grandfather, Joseph Tagg (b. c. 1870, see photo) was a blacksmith’s apprentice from Whaplode who became a Methodist minister.

The local phone book still includes a fair number of Taggs but there are many more in London. There are also plenty of Taggs in the USA (particularly in California, New England, Michigan, Maryland, New York and across the Midwest). Apart from the Taggs you can find here, here, here, here and here, I could mention my brother Roger Tagg in Adelaide (South Australia) and my brother Stephen Tagg near Glasgow (Scotland). My daughter, Mia (Maria) Tagg lives in the UK and is my favourite person.

[some day I would like to complete this part of the story!]

Tagg seems to be the most common UK variant of the North German name Tagge. Lots of Tagges live in the Hamburg area. Apart from Tagge the optician, there’s Gerd Tagge, Holger Tagge (driving school), Birger Tagge (Senate of Hamburg University), Cassandra Tagge (Bergdorf Secondary School), Gilbert Tagge (volunteer firefighter), Jürgen Tagge, Carol Tagge, Dirk Tagge, etc. You can also get your engine tuned by Marcel Tagge in Klein Bünzow near the Polish border.

There’s even a Tagge Street in New Berlin, renamed Kitchener (Ontario) after the Germanophobia generated in Canada during World War I. Tagges are quite common in the border areas between Germany and Denmark (Schleswig-Holstein, see map.). Apart from Police Inspector Jrgen Tagge of Danish Immigration, the island of Fehmarn (Puttgarden, etc.) claims to be the origin of the name Tagge. There's also Karna Tagge of the Fredensborg Golf Club, Susanne Tagge(at StorageTek in Smørum) and Norwegian youth pole-vault-champion-turned fraudster Jrn Ronnie Tagge. For a longer list of Taggs and Tagges, click here.

Among musical / artistic / university Taggs online you'll find: John Tagg, James Tagg, Graeme Tagg, Kathleen or Kathy Tagg (South African pianist), Barbara Tagg, Stanley Tagg, Lawrence E Tagg, Lawrence V Tagg, Martyn Tagg, David Tagg, Graham Tagg (lead violin, Iceland Symphony Orchestra), Alan Tagg, brothers Peter and Derek Tagg (a.k.a. Richard Targett and Vic Austin respectively, both members of the band Trudy), Nick Tagg, Ken Tagg (record producer), etc., not to mention Larry Tagg (of Bourgeois Tagg fame) and Eric Tagg (adult contemporary fusion etc.). This preponderance of musical and university-type Taggs calls into question my strong aversion to genetic determinism: we all even look alike. Check also Annie Tagg (artist from Tennessee), Brian Tagg (retired film editor, living in Jamaica and involved in the nation's One People film project to celebrate the nation's fifty years of independence), Corey Tagg (music educator from Calgary), Dan Tagg (BBC, Director of Technology, Culture Online), Howard Tagg (East Texas Food Bank charity), Julian Tagg (Exeter City Football Club), Justin Tagg (Shooter films). For more Taggs and Tagges, click here.

If Tagge and Tagg are names of Low German (North German/Danish) origin, what does tagg[e] mean? In Swedish and Norwegian tagg means thorn or spike. Tagg is also Swedish slang for a cigarette: guess how many times I heard the Philip Morris joke when I lived in Sweden (yawn). Nor does the fact that taggtråd means barbed wire in Swedish and Norwegian dissuade Scandinavians from making other sad puns on our name. Worse still, in English, nothing pleasant seems to rhyme with Tagg — bag, dag, drag, fag, gag, hag, jag, lag, nag, rag, sag, slag and wag, for example: only crag, flag and stag seem relatively inoffensive. My mother wisely advised me as a Tagg not to poke fun at other people’s names. Still, as my Swedish students once kindly remarked, ‘ingen ros utan tagg’ = ‘no rose without thorn’. Besides, if there’s nothing strange about being called Spike [e.g. Milligan] or [EMI-]Thorn[e] in English, what’s so weird about being called Tagg? As I said, we are legion and here to stay, at least until global warming melts the ice caps and releases all those billions of cubic kilometres of methane from the bottom of the ocean so that we end up like Venus (neighbouring planet, not the goddess of love). Why not start by scrapping all SUVs?


To top To topPhilip — from Greek Philippos (phil- = like, love; [h]ippos = horse): literally a male person who loves horses. Neither my parents nor the Greeks of ancient times meant that people named Philip engage in erotic acts with horses. Perhaps the Greeks meant something like speed freak since horses were the fastest mode of transport at the time. My parents, with their keen sense of assonance and language rhythm knew that a two- or three-syllable name with an accentuated vowel other than A [æ] would sound better than, for example, Jan Tagg or Ralph Tagg.

Among famous men who may have played a part in popularising the name Philip are:

This logo may have also contributed to the name’s popularity
Philip the hermeneutician

PVTASNE INTELLEGIS QVAE LEGIS
= Understandest thou what thou readest?

In the Acts of the Apostles (New Testament of the Bible), chapter 8 (verses 26-38), we are told that an angel of God instructs Philip to ‘go toward the south unto the way that goeth down from Jerusalem unto Gaza’. The passage continues (complete passage in Latin):

‘And he arose and went... And, behold, a man of Ethiopia, a eunuch of great authority under Candace queen of the Ethiopians, who had the charge of all her treasure, and had come to Jerusalem for to worship, was returning, and sitting in his chariot, reading Esaias the prophet.... Then the Spirit said unto Philip “Go near and join thyself to this chariot”. And Philip ran thither to him and heard him read the prophet and said “Understandest thou what thou readest?” And he [the Ethiopian] said “How can I, except some man should guide me? ...

After that Philip explains the passage about the Son of God being ‘led like a lamb to the slaughter’ and ends up baptising the Ethiopian. His hermeneutic skills of persuasion were certainly more effective than mine are.

Actus Apostolorum, 8: 26-38 (complete passage in Latin)

Angelus autem Domini locutus est ad Philippum, dicens “Surge et vade contra meridianum, ad viam quae descendit ab Hierusalem in Gazam: haec est deserta.” Et surgens abiit. Et ecce vir Aethiops, eunuchus, potens Candacis reginae Aethiopum, qui erat super omnes gazas eius, venerat adorare in Hierusalem et revertebatur sedens super currum suum, legensque prophetam Esaiam. Dixit autem Spiritus Philippo “Accede et adiunge te ad currum istum.” Adcurrens autem Philippus, audivit eum legentem Esaiam prophetam et dixit “Putasne intellegis quae legis?” Qui ait “Et quomodo possum, si non aliquis ostenderit mihi?” Rogavitque Philippum ut ascenderet et sederet secum. Locus autem scripturae quam legebat erat hic: “Tamquam ovis ad occisionem ductus est: et sicut agnus coram tondente se sine voce, sic non aperuit os suum. In humilitate iudicium eius sublatum est. Generationem illius quis enarrabit quoniam tollitur de terra vita eius.” Respondens autem eunuchus Philippo dixit “Obsecro te de quo propheta dicit hoc? De se an de alio aliquo?” Aperiens autem Philippus os suum et incipiens ab scriptura ista, evangelizavit illi Iesum. Et dum irent per viam, venerunt ad quandam aquam; et ait eunuchus: “Ecce aqua, quid prohibet me baptizari? Et iussit stare currum, et descenderunt uterque in aquam, Philippus et eunuchus, et baptizavit eum.

To top

93 more online Taggs

Alan Tagg UK Bristol theatre designer
Andy Tagg UK Wallingford dredger
Annie Tagg USA Nashville, TN public relations
Barbara Tagg USA Syracuse, NY conductor, music teacher
Barclay Tagg USA NY jockey and trainer
Bernd Tagge Germany Lbeck/Travemünde restauranteur
Bill Tagg UK education and IT
Birger Tagge Germany Hamburg student politics (left or course)
Brian Tagg USA Los Angeles, California film editor
Catherine Tagg UK Cardiff, Wales manager, Trevithick Library
Chris Tagg UK London student services officer
Christine Tagg USA author (children's books)
Clare Tagg UK Baldock, Herts software product management
Cynde Tagg USA NM education and research safety officer
D M Tagg & Son UK London painters and decorators
Dan Tagg UK Bristol technologist
David & Linda Tagg UK Basingstoke, Hants. physio- and aromatherapists
David Tagg USA New York, NY musician, designer and photographer
David Tagg UK London solicitor
DJ Tagg USA Mactropolis, GA DJ
Donovan Tagg UK Lancaster maths professor, my father
Eric Tagg USA Los Angeles, CA musician
Foxley Tagg UK Cheltenham, Glos. transport planners
George Tagg UK London community personality
Gerd Tagge Germany Hamburg playground equipment
Giles Tagg UK London IT and telecommunications
Graham Tagg Canada musician (viola)
Holger Tagge Germany Norderstedt (Stuttgart) driving school
Howard Tagg USA Texas bankruptcy lawyer
Jack Tagg UK Torquay, Devon WW2 bomber pilot
James Tagg UK founder and CEO of Truphone
Jason Tagg NZ/USA   Mansueto Ventures developer, ukelele player
Jeremy Tagg USA Ohio sportswriter
John Tagg USA CA educationalist
John Tagg USA Binghampton, NY art historian
John Tagg New Zealand Otago microbiologist
Jrgen Tagge Denmark København immigration police
Jrn Ronnie Tagge Norway Oslo fraudster; ran T5PC pyramid scam
Joyce & Mem Tagg Australia Tasmania botanists
Julian Tagg UK Malton, N. Yorks. likes karaoke and girls
Justin Tagg UK London filmmaker
Kathy Tagg S.Africa New York, NY Singer songwriter
Keith Tagg Canada Cochrane, AB CEO, Tagg Construction
Ken Tagg Australia Campbelltown, NSW Macdonald's franchise owner,citizen of the year
Larry Tagg USA Los Angeles, CA musician
Linda A Tagg UK Basingstoke, Hants. physiotherapists
Liz Tagg USA Los Angeles, CA make up artist and designer
Louise Tagg UK Bath volleyball trainer
Mairead Tagg UK Glasgow, Scotland psychologist and my sister-in-law
Marcel Tagge Germany Klein Bünzow AllCar Tuning
Maria (Mia) Tagg UK Liverpool caterer, thinker and my daughter
Marilee Nebelsick-Tagg USA San Marcos, CA professor of nursing education
Mark Tagg UK Northampton county cricket ground CEO
Michael Tagg USA Bel Air, MD banker
Michelle Tagg USA Overland Park, KS marketing account manager
Mrs Stewart-Tagg UK Addingham, W. Yorks. primary school teacher
Nathan Tagg USA Iowa City, Iowa doctor (MD)
Nathaniel Tagg USA Medford, MA physicist
Nick Tagg UK London playwright, literary agent
Oliver J Tagg UK London junior lawyer
Paul F Tagg USA Addison, TX estate planning lawyer
Ralph Tagg USA musician (new age Christian stuff)
Randall Tagg USA New York photographer
Rhiannon Elizabeth Tagg UK Notts. 15 yrs old, hopeful artist and poet
Richard Tagg UK Notts. golfer
Roger Tagg Australia Adelaide, SA semi-retired university teacher, my brother
Ron Tagg USA Philadelphia rock band "TAGG"
Sally Tagg NZ Auckland photographer, flower photos
Sean Tagg UK sports performance coach
Silvia Tagge Germany Döbeln safety manager
Simon Tagg UK Newcastle-under-Lyme conservative councillor
Stephen Tagg UK Glasgow, Scotland university teacher and my brother
Stephen Tagg Qatar Doha, Qatar automation salesman
Susanne Tagge DK Smørum works at Storage Tek
Sven Tagge Germany Halle political economist, Martin Luther Universität
Tagg Clothing UK Newark, Notts. equestrian clothing
Tagg Computer Training UK London computer training
Tagg (corporation) USA Texas aircraft brokerage and leasing
Tagg Designer Tools Canada Kitchener, Ontario "seyDoggyTagg"
Tagg Industries USA Laguna Hills, California medical products
Tagg Logistics USA St Louis, Missouri distribution, packaging
Tagg Media USA web design
Tagg Oram Partnership UK Baldock, Herts. Information technology
Tagg Plumbing Australia Kew, VIC plumbers
TAGG radio USA Nevada radio station
Tagg SEO USA San Francisco search engine optimisation specialists
Tagg Storage Canada North Battleford, SK storage constructors
Tagg Studios USA Albuquerque, NM studio
Tagg Team DJs USA Los Angeles, CA disco DJing
Tagg's Island UK Hampton actually in the Thames
Taylor Tagg USA Memphis, TN financial analyst
Vicki Reppert Tagg USA Fort Ann, NY amateur genealogist

To top

How much TAGG do you contain?

Here's a 780-letter sequence from the DNA part of the human genome [source]. It contains four TAGGs.

TCCTAAGCCAGTGCCAGAAGAGCCAAGGACAGGTACGGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATCTACTCCCAG GAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCATCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTC AAACAGACACCATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGGTGAGGCCCTGGG CAGGTTGGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCATGTGGAGACAGAGAAGACTCTTGGGTTTCTGATAGGCACTGACTC TCTCTGCCTATTGGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGAGTCCTTTGGGGATCTGTCCACTCCTGAT GCTGTTATGGGCAACCCTAAGGTGAAGGCTCATGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGGCACCTTTG CCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTTCAGGGTGAGTCTATGGGACCCTTGATGTTTTCTTTCCCCTTCTTTTCT
ATGGTTAAGTTCATGTCATAGGAAGGGGAGAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGATTGCATCAG

That's one TAGG every 175 letters ("bases") in the chain. I've absolutely no idea what, if anything, that means in real terms.

TAGG: a string of bases in the PLP1 gene

"[E]ach gene contains the genetic code that tells cells how to make a specific protein. The genetic code is made up of a string of bases that are represented by the letters A, C, G and T. This string of bases represents a small region of the PLP1 gene: TAGGACATCCCGACAAG" [source]. I don't know what that means either.

It also appears that the TAGG motif "can inhibit splicing" in gene mutation. It appears that TAGG in the 30-letter motif GATATCGGATAGTGTAGGGCAGGCATCGAT is "particularly effective in provoking exon skipping, cumulating the effects of a stop codon with those linked to the creation of a splicing repression sequence" [source]. Once again, I have no clue whatsoever as to what that might mean.

If you know what any of this actually means, please click here and let me know in layman's terms!


To top